Mouse CD99L2 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGB411-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
714bp
Gene Synonym
Xap89, Mic2l1, AW548191, Cd99l2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse CD99 antigen-like 2 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
CD99 antigen-like protein 2, also known as MIC2-like protein 1, CD99L2 and MIC2L1, is a single-pass type I  membrane protein which belongs to the CD99 family. CD99L2 is expressed in brain, heart, lung, liver, spleen, kidney, stomach, small intestine, skeletal muscle, ovary, thymus, testis and uterus. Lower expression of CD99L2 is seen in thymus. It is also expressed in E18 uterus and placenta. CD99 and CD99L2 were required for leukocyte extravasation in the cremaster after stimulation with tumor necrosis factor-alpha, where the need for PECAM-1 is known to be bypassed. CD99 and CD99L2 act independently of PECAM-1 in leukocyte extravasation and cooperate in an independent way to help neutrophils overcome the endothelial basement membrane. CD99L2 may function as a homophilic adhesion molecule. It functions in leukocyte-endothelial cell interactions during leukocyte extravasation, and in particular, at the diapedesis step. CD99L2 does not seem to be involved in docking of leukocytes to the vessel wall or in lymphocyte diapedesis.
References
  • Suh, YH. et al., 2003, Gene. 307: 63-76.
  • Park,S.H. Gene 2005, 353 (2):177-88.
  • Schenkel, AR et al., 2007, Cell Commun Adhes. 14 (5):227-37.
  • Bixel, MG. et al., 2010, Blood. 116 (7):1172-84. 
  • TOP