Mouse CD99L2 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001199349.1

RefSeq ORF Size

714bp

Gene Synonym

Xap89, Mic2l1, AW548191, Cd99l2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse CD99 antigen-like 2 transcript variant 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

CD99 antigen-like protein 2, also known as MIC2-like protein 1, CD99L2 and MIC2L1, is a single-pass type I membrane protein which belongs to the CD99 family. CD99L2 is expressed in brain, heart, lung, liver, spleen, kidney, stomach, small intestine, skeletal muscle, ovary, thymus, testis and uterus. Lower expression of CD99L2 is seen in thymus. It is also expressed in E18 uterus and placenta. CD99 and CD99L2 were required for leukocyte extravasation in the cremaster after stimulation with tumor necrosis factor-alpha, where the need for PECAM-1 is known to be bypassed. CD99 and CD99L2 act independently of PECAM-1 in leukocyte extravasation and cooperate in an independent way to help neutrophils overcome the endothelial basement membrane. CD99L2 may function as a homophilic adhesion molecule. It functions in leukocyte-endothelial cell interactions during leukocyte extravasation, and in particular, at the diapedesis step. CD99L2 does not seem to be involved in docking of leukocytes to the vessel wall or in lymphocyte diapedesis.

References

Suh, YH. et al., 2003, Gene. 307: 63-76.

Park,S.H. Gene 2005, 353 (2):177-88.

Schenkel, AR et al., 2007, Cell Commun Adhes. 14 (5):227-37.

Bixel, MG. et al., 2010, Blood. 116 (7):1172-84.

Catalog Number:MGB411-NM