Rat Cathepsin B/CTSB Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:MGB139-CY

Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1020bp
Gene Synonym
Ctsb
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Rat cathepsin B Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Cathepsin B is a papain-family cysteine protease that is normally located in lysosomes, where it is involved in the turnover of proteins and plays various roles in maintaining the normal metabolism of cells. This protease has been implicated in pathological conditions, e.g., tumor progression and arthritis. In disease conditions, increases in the expression of cathepsin B occur at both the gene and protein levels. Cathepsin B is synthesized as a preproenzyme and the primary pathways for its normal trafficking to the lysosome utilize mannose 6-phosphate receptors (MPRs). Mature cathepsin B has the ability to degrade several extracellular matrix components at both neutral and acidic pH and has been implicated in the progression of several human and rodent tumors progression and arthritis. Cathepsin B expression is increased in many human cancers at the mRNA, protein and activity levels. It is also frequently overexpressed in premalignant lesions, an observation that associates this protease with local invasive stages of cancer. Increased expression of cathepsin B in primary cancers, and especially in preneoplastic lesions, suggests that this enzyme might have pro-apoptotic features. Active cathepsin B is also secreted from tumours, a mechanism likely to be facilitated by lysosomal exocytosis or extracellular processing by surface activators. Cathepsin B is localized to caveolae on the tumour surface, where binding to the annexin II heterotetramer occurs. Thus CTSB is suggested as a tumor marker. Additionally, Cathepsin B can degrade extracellular matrix proteins, such as collagen IV and laminin, and can activate the precursor form of urokinase plasminogen activator (uPA), perhaps thereby initiating an extracellular proteolytic cascade.
References
  • Mai J, et al. (2000) Cell surface complex of cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta. 1477(1-2): 215-30.
  • Podgorski I, et al. (2003) Cathepsin B and its role(s) in cancer progression. Biochem Soc Symp. (70): 263-76.
  • Yan S, et al. (2003) Molecular regulation of human cathepsin B: implication in pathologies. Biol Chem. 384(6): 845-54.
  • Roshy S, et al. (2003) Pericellular cathepsin B and malignant progression. Cancer Metastasis Rev. 22(2-3): 271-86.
  •  

    TOP