Rat Cathepsin B/CTSB Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Rat

NCBI Ref Seq

NM_022597.2

RefSeq ORF Size

1020bp

Gene Synonym

Ctsb

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat cathepsin B Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cathepsin B is a papain-family cysteine protease that is normally located in lysosomes, where it is involved in the turnover of proteins and plays various roles in maintaining the normal metabolism of cells. This protease has been implicated in pathological conditions, e.g., tumor progression and arthritis. In disease conditions, increases in the expression of cathepsin B occur at both the gene and protein levels. Cathepsin B is synthesized as a preproenzyme and the primary pathways for its normal trafficking to the lysosome utilize mannose 6-phosphate receptors (MPRs). Mature cathepsin B has the ability to degrade several extracellular matrix components at both neutral and acidic pH and has been implicated in the progression of several human and rodent tumors progression and arthritis. Cathepsin B expression is increased in many human cancers at the mRNA, protein and activity levels. It is also frequently overexpressed in premalignant lesions, an observation that associates this protease with local invasive stages of cancer. Increased expression of cathepsin B in primary cancers, and especially in preneoplastic lesions, suggests that this enzyme might have pro-apoptotic features. Active cathepsin B is also secreted from tumours, a mechanism likely to be facilitated by lysosomal exocytosis or extracellular processing by surface activators. Cathepsin B is localized to caveolae on the tumour surface, where binding to the annexin II heterotetramer occurs. Thus CTSB is suggested as a tumor marker. Additionally, Cathepsin B can degrade extracellular matrix proteins, such as collagen IV and laminin, and can activate the precursor form of urokinase plasminogen activator (uPA), perhaps thereby initiating an extracellular proteolytic cascade.

References

Mai J, et al. (2000) Cell surface complex of cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta. 1477(1-2): 215-30.

Podgorski I, et al. (2003) Cathepsin B and its role(s) in cancer progression. Biochem Soc Symp. (70): 263-76.

Yan S, et al. (2003) Molecular regulation of human cathepsin B: implication in pathologies. Biol Chem. 384(6): 845-54.

Roshy S, et al. (2003) Pericellular cathepsin B and malignant progression. Cancer Metastasis Rev. 22(2-3): 271-86.

Catalog Number:MGB139-CM