Rat Cathepsin B/CTSB Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Rat

NCBI Ref Seq

NM_022597.2

RefSeq ORF Size

1020bp

Gene Synonym

Ctsb

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Rat cathepsin B Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Cathepsin B is a papain-family cysteine protease that is normally located in lysosomes, where it is involved in the turnover of proteins and plays various roles in maintaining the normal metabolism of cells. This protease has been implicated in pathological conditions, e.g., tumor progression and arthritis. In disease conditions, increases in the expression of cathepsin B occur at both the gene and protein levels. Cathepsin B is synthesized as a preproenzyme and the primary pathways for its normal trafficking to the lysosome utilize mannose 6-phosphate receptors (MPRs). Mature cathepsin B has the ability to degrade several extracellular matrix components at both neutral and acidic pH and has been implicated in the progression of several human and rodent tumors progression and arthritis. Cathepsin B expression is increased in many human cancers at the mRNA, protein and activity levels. It is also frequently overexpressed in premalignant lesions, an observation that associates this protease with local invasive stages of cancer. Increased expression of cathepsin B in primary cancers, and especially in preneoplastic lesions, suggests that this enzyme might have pro-apoptotic features. Active cathepsin B is also secreted from tumours, a mechanism likely to be facilitated by lysosomal exocytosis or extracellular processing by surface activators. Cathepsin B is localized to caveolae on the tumour surface, where binding to the annexin II heterotetramer occurs. Thus CTSB is suggested as a tumor marker. Additionally, Cathepsin B can degrade extracellular matrix proteins, such as collagen IV and laminin, and can activate the precursor form of urokinase plasminogen activator (uPA), perhaps thereby initiating an extracellular proteolytic cascade.

References

Mai J, et al. (2000) Cell surface complex of cathepsin B/annexin II tetramer in malignant progression. Biochim Biophys Acta. 1477(1-2): 215-30.

Podgorski I, et al. (2003) Cathepsin B and its role(s) in cancer progression. Biochem Soc Symp. (70): 263-76.

Yan S, et al. (2003) Molecular regulation of human cathepsin B: implication in pathologies. Biol Chem. 384(6): 845-54.

Roshy S, et al. (2003) Pericellular cathepsin B and malignant progression. Cancer Metastasis Rev. 22(2-3): 271-86.

Catalog Number:MGB139-CF