Mouse Cathepsin A/CTSA Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:MGB138-NM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1425bp
Gene Synonym
PPCA, Ppgb, AU019505, Ctsa
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cathepsin A Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lysosomal carboxypeptidase, cathepsin A (protective protein, CathA), is a component of the lysosomal multienzyme complex along with beta-galactosidase (GAL) and sialidase Neu1, where it activates Neu1 and protects GAL and Neu1 against the rapid proteolytic degradation. Cathepsin A is a multicatalytic enzyme with deamidase and esterase in addition to carboxypeptidase activities. It was recently identified in human platelets as deamidase. In vitro, it hydrolyzes a variety of bioactive peptide hormones including tachykinins, suggesting that extralysosomal cathepsin A plays a role in regulation of bioactive peptide functions. It is a member of the alpha/beta hydrolase fold family and has been suggested to share a common ancestral relationship with other alpha/beta hydrolase fold enzymes, such as cholinesterases. Cathepsin A defects are linked to multiple forms of Galactosialidosis with a combined secondary deficiency of beta-galactosidase and neuraminidase. Cathepsin A is a key molecule in the onset of galactosialidosis and also highlight the therapeutic acts in vivo as an endothelin-1-inactivating enzyme and strongly confirm a crucial role of this enzyme in effective elastic fiber formation.
References
  • Hiraiwa M. (1999) Cathepsin A/protective protein: an unusual lysosomal multifunctional protein. Cell Mol Life Sci. 56(11-12): 894-907.
  • Yoshida T, et al. (2006) Comparative analysis of binding energy of chymostatin with human cathepsin A and its homologous proteins by molecular orbital calculation. J Chem Inf Model. 46(5): 2093-103.
  • Seyrantepe V, et al. (2008) Enzymatic activity of lysosomal carboxypeptidase (cathepsin) A is required for proper elastic fiber formation and inactivation of endothelin-1. Circulation. 117(15): 1973-81.
  • TOP