Mouse Cathepsin A/CTSA Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGB138-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1425bp
Gene Synonym
PPCA, Ppgb, AU019505, Ctsa
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse cathepsin A Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lysosomal carboxypeptidase, cathepsin A (protective protein, CathA), is a component of the lysosomal multienzyme complex along with beta-galactosidase (GAL) and sialidase Neu1, where it activates Neu1 and protects GAL and Neu1 against the rapid proteolytic degradation. Cathepsin A is a multicatalytic enzyme with deamidase and esterase in addition to carboxypeptidase activities. It was recently identified in human platelets as deamidase. In vitro, it hydrolyzes a variety of bioactive peptide hormones including tachykinins, suggesting that extralysosomal cathepsin A plays a role in regulation of bioactive peptide functions. It is a member of the alpha/beta hydrolase fold family and has been suggested to share a common ancestral relationship with other alpha/beta hydrolase fold enzymes, such as cholinesterases. Cathepsin A defects are linked to multiple forms of Galactosialidosis with a combined secondary deficiency of beta-galactosidase and neuraminidase. Cathepsin A is a key molecule in the onset of galactosialidosis and also highlight the therapeutic acts in vivo as an endothelin-1-inactivating enzyme and strongly confirm a crucial role of this enzyme in effective elastic fiber formation.
References
  • Hiraiwa M. (1999) Cathepsin A/protective protein: an unusual lysosomal multifunctional protein. Cell Mol Life Sci. 56(11-12): 894-907.
  • Yoshida T, et al. (2006) Comparative analysis of binding energy of chymostatin with human cathepsin A and its homologous proteins by molecular orbital calculation. J Chem Inf Model. 46(5): 2093-103.
  • Seyrantepe V, et al. (2008) Enzymatic activity of lysosomal carboxypeptidase (cathepsin) A is required for proper elastic fiber formation and inactivation of endothelin-1. Circulation. 117(15): 1973-81.
  • TOP