Mouse Cathepsin A/CTSA Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_001038492.1

RefSeq ORF Size

1425bp

Gene Synonym

PPCA, Ppgb, AU019505, Ctsa

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse cathepsin A Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lysosomal carboxypeptidase, cathepsin A (protective protein, CathA), is a component of the lysosomal multienzyme complex along with beta-galactosidase (GAL) and sialidase Neu1, where it activates Neu1 and protects GAL and Neu1 against the rapid proteolytic degradation. Cathepsin A is a multicatalytic enzyme with deamidase and esterase in addition to carboxypeptidase activities. It was recently identified in human platelets as deamidase. In vitro, it hydrolyzes a variety of bioactive peptide hormones including tachykinins, suggesting that extralysosomal cathepsin A plays a role in regulation of bioactive peptide functions. It is a member of the alpha/beta hydrolase fold family and has been suggested to share a common ancestral relationship with other alpha/beta hydrolase fold enzymes, such as cholinesterases. Cathepsin A defects are linked to multiple forms of Galactosialidosis with a combined secondary deficiency of beta-galactosidase and neuraminidase. Cathepsin A is a key molecule in the onset of galactosialidosis and also highlight the therapeutic acts in vivo as an endothelin-1-inactivating enzyme and strongly confirm a crucial role of this enzyme in effective elastic fiber formation.

References

Hiraiwa M. (1999) Cathepsin A/protective protein: an unusual lysosomal multifunctional protein. Cell Mol Life Sci. 56(11-12): 894-907.

Yoshida T, et al. (2006) Comparative analysis of binding energy of chymostatin with human cathepsin A and its homologous proteins by molecular orbital calculation. J Chem Inf Model. 46(5): 2093-103.

Seyrantepe V, et al. (2008) Enzymatic activity of lysosomal carboxypeptidase (cathepsin) A is required for proper elastic fiber formation and inactivation of endothelin-1. Circulation. 117(15): 1973-81.

Catalog Number:MGB138-CY