Mouse BLK Kinase Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:MGA822-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1500bp
Gene Synonym
Blk
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse B lymphoid kinase Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tyrosine-protein kinase Blk, also known as B lymphocyte kinase, p55-Blk and BLK, is a member of the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. BLK / p55-Blk is expressed in lymphatic organs, pancreatic islets, Leydig cells, striate ducts of salivary glands and hair follicles. BLK / p55-Blk is a src-family protein tyrosine kinase specifically expressed in B-lineage cells of mice. The early onset of Blk expression during B-cell development in the bone marrow and the high expression levels of Blk in mature B cells suggest a possible important role of Blk in B-cell physiology. It is a modulator of beta-cells function, acting through the up-regulation of PDX1 and NKX6-1 and consequent stimulation of insulin secretion in response to glucose. Defects in BLK are a cause of maturity-onset diabetes of the young type 11 which is a form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease.
References
  • Dymecki,S.M. et al., 1992, J Biol Chem. 267 (7):4815-23.
  • Drebin J.A. et al., 1995, Oncogene 10:477-86.
  • Islam K.B.et al., 1995, J. Immunol. 154:1265-72.
  • Texido,G. et al., 2000, Mol Cell Biol. 20 (4):1227-33.
  • Borowiec M. et al., 2009, Proc. Natl. Acad. Sci. USA. 106: 14460-5.
  • TOP