Mouse BLK Kinase Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:MGA822-NF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1500bp
Gene Synonym
Blk
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse B lymphoid kinase Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Tyrosine-protein kinase Blk, also known as B lymphocyte kinase, p55-Blk and BLK, is a member of the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. BLK / p55-Blk is expressed in lymphatic organs, pancreatic islets, Leydig cells, striate ducts of salivary glands and hair follicles. BLK / p55-Blk is a src-family protein tyrosine kinase specifically expressed in B-lineage cells of mice. The early onset of Blk expression during B-cell development in the bone marrow and the high expression levels of Blk in mature B cells suggest a possible important role of Blk in B-cell physiology. It is a modulator of beta-cells function, acting through the up-regulation of PDX1 and NKX6-1 and consequent stimulation of insulin secretion in response to glucose. Defects in BLK are a cause of maturity-onset diabetes of the young type 11 which is a form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease.
References
  • Dymecki,S.M. et al., 1992, J Biol Chem. 267 (7):4815-23.
  • Drebin J.A. et al., 1995, Oncogene 10:477-86.
  • Islam K.B.et al., 1995, J. Immunol. 154:1265-72.
  • Texido,G. et al., 2000, Mol Cell Biol. 20 (4):1227-33.
  • Borowiec M. et al., 2009, Proc. Natl. Acad. Sci. USA. 106: 14460-5.
  • TOP