Mouse BLK Kinase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007549.2

RefSeq ORF Size

1500bp

Gene Synonym

Blk

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse B lymphoid kinase Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Tyrosine-protein kinase Blk, also known as B lymphocyte kinase, p55-Blk and BLK, is a member of the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. BLK / p55-Blk is expressed in lymphatic organs, pancreatic islets, Leydig cells, striate ducts of salivary glands and hair follicles. BLK / p55-Blk is a src-family protein tyrosine kinase specifically expressed in B-lineage cells of mice. The early onset of Blk expression during B-cell development in the bone marrow and the high expression levels of Blk in mature B cells suggest a possible important role of Blk in B-cell physiology. It is a modulator of beta-cells function, acting through the up-regulation of PDX1 and NKX6-1 and consequent stimulation of insulin secretion in response to glucose. Defects in BLK are a cause of maturity-onset diabetes of the young type 11 which is a form of diabetes that is characterized by an autosomal dominant mode of inheritance, onset in childhood or early adulthood (usually before 25 years of age), a primary defect in insulin secretion and frequent insulin-independence at the beginning of the disease.

References

Dymecki,S.M. et al., 1992, J Biol Chem. 267 (7):4815-23.

Drebin J.A. et al., 1995, Oncogene 10:477-86.

Islam K.B.et al., 1995, J. Immunol. 154:1265-72.

Texido,G. et al., 2000, Mol Cell Biol. 20 (4):1227-33.

Borowiec M. et al., 2009, Proc. Natl. Acad. Sci. USA. 106: 14460-5.

Catalog Number:MGA822-CM