Mouse BAMBI/NMA Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_026505.2

RefSeq ORF Size

783bp

Gene Synonym

2610003H06Rik, Bambi

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) Gene ORF cDNA clone expression plasmid,N terminal GFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-GFPSpark

Restriction Site

Protein Tag

GFPSpark

Tag Sequence

GTGAGCAAGGGC……GAGCTGTACAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

GFPSpark Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

BMP and activin membrane-bound inhibitor (BAMBI) is a transmembrane glycoprotein that is a pseudoreceptor of type 1 receptors. BAMBI structurally lacks intracellular serine/ threonine kinase domain but with an extracellular domain and a short cytoplasmic region that share sequence similarities with type 1 receptors, whose members have functions in signal transduction in various developing and pathological processes. BAMBI competes with the type 1 receptor, a receptor of the transforming growth factor-beta (TGF-beta), through functioning as negative regulators of TGF-beta by limiting the signaling range of the TGF-beta family during early embryogenesis. The expression of BAMBI can be induced by accumulated beta-catenin and BMP. The expression level of BAMBI was found aberrantly elevated in most colorectal and hepatocellular carcinomas relative to the corresponding non-cancerous tissues. It suggestes that beta-catenin and TGF-beta interfere growth arrest by inducing the expression of BAMBI, and this may contribute to colorectal and hepatocellular tumorigenesis.

References

Sekiya T, et al. (2003) Identification of BMP and Activin Membrane-bound Inhibitor (BAMBI), an Inhibitor of Transforming Growth Factor- Signaling, as a Target of the -Catenin Pathway in Colorectal Tumor Cells. The Journal of Biological Chemistry. 279:6840-6.

Shi YG, et al. (2003) Mechanisms of TGF- Signaling from Cell Membrane to the Nucleus. Cell. 113(6): 685-700.

Wanninger J, et al. (2011) Adiponectin induces the transforming growth factor decoy receptor BAMBI in human hepatocytes. FEBS Lett. 585(9):1338-44.

Catalog Number:MGA739-NG