Mouse BAMBI/NMA Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:MGA739-CF

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
783bp
Gene Synonym
2610003H06Rik, Bambi
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BMP and activin membrane-bound inhibitor (BAMBI) is a transmembrane glycoprotein that is a pseudoreceptor of type 1 receptors. BAMBI structurally lacks intracellular serine/ threonine kinase domain but with an extracellular domain and a short cytoplasmic region that share sequence similarities with type 1 receptors, whose members have functions in signal transduction in various developing and pathological processes. BAMBI competes with the type 1 receptor, a receptor of the transforming growth factor-beta (TGF-beta), through functioning as negative regulators of TGF-beta by limiting the signaling range of the TGF-beta family during early embryogenesis. The expression of BAMBI can be induced by accumulated beta-catenin and BMP. The expression level of BAMBI was found aberrantly elevated in most colorectal and hepatocellular carcinomas relative to the corresponding non-cancerous tissues. It suggestes that beta-catenin and TGF-beta interfere growth arrest by inducing the expression of BAMBI, and this may contribute to colorectal and hepatocellular tumorigenesis.
References
  • Sekiya T, et al. (2003) Identification of BMP and Activin Membrane-bound Inhibitor (BAMBI), an Inhibitor of Transforming Growth Factor- Signaling, as a Target of the -Catenin Pathway in Colorectal Tumor Cells. The Journal of Biological Chemistry. 279:6840-6.
  • Shi YG, et al. (2003) Mechanisms of TGF- Signaling from Cell Membrane to the Nucleus. Cell. 113(6): 685-700.
  • Wanninger J, et al. (2011) Adiponectin induces the transforming growth factor decoy receptor BAMBI in human hepatocytes. FEBS Lett. 585(9):1338-44.
  • TOP