Mouse BAMBI/NMA Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:MGA739-CM

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
783bp
Gene Synonym
2610003H06Rik, Bambi
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse BMP and activin membrane-bound inhibitor, homolog (Xenopus laevis) Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
BMP and activin membrane-bound inhibitor (BAMBI) is a transmembrane glycoprotein that is a pseudoreceptor of type 1 receptors. BAMBI structurally lacks intracellular serine/ threonine kinase domain but with an extracellular domain and a short cytoplasmic region that share sequence similarities with type 1 receptors, whose members have functions in signal transduction in various developing and pathological processes. BAMBI competes with the type 1 receptor, a receptor of the transforming growth factor-beta (TGF-beta), through functioning as negative regulators of TGF-beta by limiting the signaling range of the TGF-beta family during early embryogenesis. The expression of BAMBI can be induced by accumulated beta-catenin and BMP. The expression level of BAMBI was found aberrantly elevated in most colorectal and hepatocellular carcinomas relative to the corresponding non-cancerous tissues. It suggestes that beta-catenin and TGF-beta interfere growth arrest by inducing the expression of BAMBI, and this may contribute to colorectal and hepatocellular tumorigenesis.
References
  • Sekiya T, et al. (2003) Identification of BMP and Activin Membrane-bound Inhibitor (BAMBI), an Inhibitor of Transforming Growth Factor- Signaling, as a Target of the -Catenin Pathway in Colorectal Tumor Cells. The Journal of Biological Chemistry. 279:6840-6.
  • Shi YG, et al. (2003) Mechanisms of TGF- Signaling from Cell Membrane to the Nucleus. Cell. 113(6): 685-700.
  • Wanninger J, et al. (2011) Adiponectin induces the transforming growth factor decoy receptor BAMBI in human hepatocytes. FEBS Lett. 585(9):1338-44.
  • TOP