Human YES1/c-Yes Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_005433.3

RefSeq ORF Size

1632bp

Gene Synonym

Yes; c-yes; HsT441; P61-YES

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human YES proto-oncogene 1, Src family tyrosine kinase Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Proto-oncogene tyrosine-protein kinase Yes, also known as Proto-oncogene c-Yes, p61-Yes and YES1, is a cytoplasm protein which belongs to the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. YES1 / c-Yes contains one protein kinase domain, one SH2 domain and one SH3 domain. It is thought that the subcellular distribution of Src-family tyrosine kinases, including c-Yes binding to the cellular membrane, is membranous and/or cytoplasmic. YES1 / c-Yes protein tyrosine kinase is known to be related to malignant transformation. YES1 / c-Yes and c-Src are the two most closely related members of the Src family of nonreceptor tyrosine kinases. Although there is much evidence to support redundancy in signaling between these two kinases. YES1 / c-Yes promotes formation of the tight junction by phosphorylating occludin, while c-Src signaling downregulates occludin formation in a Raf-1 dependent manner. YES1 / c-Yes has tyrosine kinase activity. It promotes infectivity of Neisseria gonorrhoeae in epithelial cells by phosphorylating MCP / CD46.

References

Summy,J.M. et al., 2003, Front Biosci 8 :s185-205.

Clump,D.A. et al., 2005, Growth Factors 23 (4):263-72.

Nonomura,T. et al., 2007,Int J Oncol 30 (1):105-11.

Catalog Number:HGI494-CY