Human YES1/c-Yes Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGI494-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1632bp
Gene Synonym
Yes; c-yes; HsT441; P61-YES
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human YES proto-oncogene 1, Src family tyrosine kinase Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Proto-oncogene tyrosine-protein kinase Yes, also known as Proto-oncogene c-Yes, p61-Yes and YES1, is a cytoplasm protein which belongs to the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. YES1 / c-Yes contains one protein kinase domain, one SH2 domain and one SH3 domain. It is thought that the subcellular distribution of Src-family tyrosine kinases, including c-Yes binding to the cellular membrane, is membranous and/or cytoplasmic. YES1 / c-Yes protein tyrosine kinase is known to be related to malignant transformation. YES1 / c-Yes and c-Src are the two most closely related members of the Src family of nonreceptor tyrosine kinases. Although there is much evidence to support redundancy in signaling between these two kinases. YES1 / c-Yes promotes formation of the tight junction by phosphorylating occludin, while c-Src signaling downregulates occludin formation in a Raf-1 dependent manner. YES1 / c-Yes has tyrosine kinase activity. It promotes infectivity of Neisseria gonorrhoeae in epithelial cells by phosphorylating MCP / CD46.
References
  • Summy,J.M. et al., 2003, Front Biosci  8 :s185-205.
  • Clump,D.A. et al., 2005, Growth Factors  23 (4):263-72.
  • Nonomura,T. et al., 2007,Int J Oncol  30 (1):105-11.
  • TOP