Human YES1/c-Yes Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Catalog Number:HGI494-CM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1632bp
Gene Synonym
Yes; c-yes; HsT441; P61-YES
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human YES proto-oncogene 1, Src family tyrosine kinase Gene ORF cDNA clone expression plasmid,C terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Proto-oncogene tyrosine-protein kinase Yes, also known as Proto-oncogene c-Yes, p61-Yes and YES1, is a cytoplasm protein which belongs to the protein kinase superfamily, Tyr protein kinase family and SRC subfamily. YES1 / c-Yes contains one protein kinase domain, one SH2 domain and one SH3 domain. It is thought that the subcellular distribution of Src-family tyrosine kinases, including c-Yes binding to the cellular membrane, is membranous and/or cytoplasmic. YES1 / c-Yes protein tyrosine kinase is known to be related to malignant transformation. YES1 / c-Yes and c-Src are the two most closely related members of the Src family of nonreceptor tyrosine kinases. Although there is much evidence to support redundancy in signaling between these two kinases. YES1 / c-Yes promotes formation of the tight junction by phosphorylating occludin, while c-Src signaling downregulates occludin formation in a Raf-1 dependent manner. YES1 / c-Yes has tyrosine kinase activity. It promotes infectivity of Neisseria gonorrhoeae in epithelial cells by phosphorylating MCP / CD46.
References
  • Summy,J.M. et al., 2003, Front Biosci  8 :s185-205.
  • Clump,D.A. et al., 2005, Growth Factors  23 (4):263-72.
  • Nonomura,T. et al., 2007,Int J Oncol  30 (1):105-11.
  • TOP