Human SETD7/SET7/9 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGG974-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1101bp
Gene Synonym
KMT7, SET7, SET9, SET7/9, FLJ21193, KIAA1717, SETD7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SET domain containing (lysine methyltransferase) 7 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Histone-lysine N-methyltransferase SETD7, also known as SET domain containing (lysine methyltransferase) 7, SET7/9, Histone H3-K4 methyltransferase SETD7, H3-K4-HMTase SETD7, and SETD7, is a member of the histone-lysine methyltransferase family and SET7 subfamily. SETD7 is widely expressed and expressed in pancreatic islets. SETD7 contains three MORN repeats and one SET domain. SETD7 plays a central role in the transcriptional activation of genes such as collagenase or insulin. As a protein lysine methyltransferase (PKMT), SETD7 also has methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding in substrate proteins. The mono-methyltransferase activity of SETD7 is achieved by disrupting the formation at near-attack conformations for the dimethylation reaction. SETD7 is also a novel coactivator of NF-kappaB and plays a role in inflammation and diabetes.
References
  • Wang, H. et al., 2002, Mol Cell 8 (6): 1207-17. 
  • Jacobs, SA. et al., 2002, Nat. Struct. Biol. 9 (11): 833-8. 
  • Xiao B, et al., 2003, Nature. 421 (6923): 652-6.
  • Martens, JH. et al., 2003, Mol. Cell. Biol. 23: 1808-1816.
  • Couture, JF. et al., 2006, Nat Struct Mol Biol  13 (2): 140-6.
  • TOP