Human SETD7/SET7/9 Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGG974-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1101bp
Gene Synonym
KMT7, SET7, SET9, SET7/9, FLJ21193, KIAA1717, SETD7
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human SET domain containing (lysine methyltransferase) 7 Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Histone-lysine N-methyltransferase SETD7, also known as SET domain containing (lysine methyltransferase) 7, SET7/9, Histone H3-K4 methyltransferase SETD7, H3-K4-HMTase SETD7, and SETD7, is a member of the histone-lysine methyltransferase family and SET7 subfamily. SETD7 is widely expressed and expressed in pancreatic islets. SETD7 contains three MORN repeats and one SET domain. SETD7 plays a central role in the transcriptional activation of genes such as collagenase or insulin. As a protein lysine methyltransferase (PKMT), SETD7 also has methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding in substrate proteins. The mono-methyltransferase activity of SETD7 is achieved by disrupting the formation at near-attack conformations for the dimethylation reaction. SETD7 is also a novel coactivator of NF-kappaB and plays a role in inflammation and diabetes.
References
  • Wang, H. et al., 2002, Mol Cell 8 (6): 1207-17. 
  • Jacobs, SA. et al., 2002, Nat. Struct. Biol. 9 (11): 833-8. 
  • Xiao B, et al., 2003, Nature. 421 (6923): 652-6.
  • Martens, JH. et al., 2003, Mol. Cell. Biol. 23: 1808-1816.
  • Couture, JF. et al., 2006, Nat Struct Mol Biol  13 (2): 140-6.
  • TOP