Human SETD7/SET7/9 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_030648.2

RefSeq ORF Size

1101bp

Gene Synonym

KMT7, SET7, SET9, SET7/9, FLJ21193, KIAA1717, SETD7

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human SET domain containing (lysine methyltransferase) 7 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Histone-lysine N-methyltransferase SETD7, also known as SET domain containing (lysine methyltransferase) 7, SET7/9, Histone H3-K4 methyltransferase SETD7, H3-K4-HMTase SETD7, and SETD7, is a member of the histone-lysine methyltransferase family and SET7 subfamily. SETD7 is widely expressed and expressed in pancreatic islets. SETD7 contains three MORN repeats and one SET domain. SETD7 plays a central role in the transcriptional activation of genes such as collagenase or insulin. As a protein lysine methyltransferase (PKMT), SETD7 also has methyltransferase activity toward non-histone proteins such as p53/TP53, TAF10, and possibly TAF7 by recognizing and binding in substrate proteins. The mono-methyltransferase activity of SETD7 is achieved by disrupting the formation at near-attack conformations for the dimethylation reaction. SETD7 is also a novel coactivator of NF-kappaB and plays a role in inflammation and diabetes.

References

Wang, H. et al., 2002, Mol Cell 8 (6): 1207-17.

Jacobs, SA. et al., 2002, Nat. Struct. Biol. 9 (11): 833-8.

Xiao B, et al., 2003, Nature. 421 (6923): 652-6.

Martens, JH. et al., 2003, Mol. Cell. Biol. 23: 1808-1816.

Couture, JF. et al., 2006, Nat Struct Mol Biol 13 (2): 140-6.

Catalog Number:HGG974-NO