Human S100A1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGG787-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
285bp
Gene Synonym
S100A1, S100, S100A, S100-alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A1 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
S100A1 is a Ca2+binding protein of the EF-hand type that belongs to the S100 protein family. S100 proteins consisting of at least 19 members exist as dimers in the cytoplasm and/or nucleus of a wide range of cells, and are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation.This protein has been shown to function in the processes including stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of PKC-mediated phosphorylation.. Phosphoglucomutase is a target protein whose activity is antagonistically regulated by S100A1, and recently, S100A1 is also identified as a potent molecular chaperone and a new member of the Hsp70/Hsp90 multichaperone complex. S100A1 displays a tissue-specific expression pattern with highest levels in myocardium and is considered to be an important regulator of cardiac contractility. Accordingly, reduced expression or mutations of S100A1 gene have been implicated in cardiomyopathies.
References
  • Remppis, A .et al., 1996, Biochim. Biophs. Acta. 1313: 253-257.
  • Most, P. et al., 2001, Proc. Natl. Acad. Sci. U.S.A. 98: 13889-13894
  • Okada, M. et al., 2004, J. Biol. Chem. 279: 4221-4233.
  • Schafer, W.E. et al., 1995, Genomics. 25: 638-643.
  • Landar, A. et al., 1996, Cell. Calcium. 20: 279-285.
  • TOP