Human S100A1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGG787-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
285bp
Gene Synonym
S100A1, S100, S100A, S100-alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
S100A1 is a Ca2+binding protein of the EF-hand type that belongs to the S100 protein family. S100 proteins consisting of at least 19 members exist as dimers in the cytoplasm and/or nucleus of a wide range of cells, and are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation.This protein has been shown to function in the processes including stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of PKC-mediated phosphorylation.. Phosphoglucomutase is a target protein whose activity is antagonistically regulated by S100A1, and recently, S100A1 is also identified as a potent molecular chaperone and a new member of the Hsp70/Hsp90 multichaperone complex. S100A1 displays a tissue-specific expression pattern with highest levels in myocardium and is considered to be an important regulator of cardiac contractility. Accordingly, reduced expression or mutations of S100A1 gene have been implicated in cardiomyopathies.
References
  • Remppis, A .et al., 1996, Biochim. Biophs. Acta. 1313: 253-257.
  • Most, P. et al., 2001, Proc. Natl. Acad. Sci. U.S.A. 98: 13889-13894
  • Okada, M. et al., 2004, J. Biol. Chem. 279: 4221-4233.
  • Schafer, W.E. et al., 1995, Genomics. 25: 638-643.
  • Landar, A. et al., 1996, Cell. Calcium. 20: 279-285.
  • TOP