Human S100A1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Catalog Number:HGG787-CY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
285bp
Gene Synonym
S100A1, S100, S100A, S100-alpha
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human S100 calcium binding protein A1 Gene ORF cDNA clone expression plasmid,C terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
S100A1 is a Ca2+binding protein of the EF-hand type that belongs to the S100 protein family. S100 proteins consisting of at least 19 members exist as dimers in the cytoplasm and/or nucleus of a wide range of cells, and are involved in the regulation of a number of cellular processes such as cell-cycle progression and cell differentiation.This protein has been shown to function in the processes including stimulation of Ca2+-induced Ca2+ release, inhibition of microtubule assembly, and inhibition of PKC-mediated phosphorylation.. Phosphoglucomutase is a target protein whose activity is antagonistically regulated by S100A1, and recently, S100A1 is also identified as a potent molecular chaperone and a new member of the Hsp70/Hsp90 multichaperone complex. S100A1 displays a tissue-specific expression pattern with highest levels in myocardium and is considered to be an important regulator of cardiac contractility. Accordingly, reduced expression or mutations of S100A1 gene have been implicated in cardiomyopathies.
References
  • Remppis, A .et al., 1996, Biochim. Biophs. Acta. 1313: 253-257.
  • Most, P. et al., 2001, Proc. Natl. Acad. Sci. U.S.A. 98: 13889-13894
  • Okada, M. et al., 2004, J. Biol. Chem. 279: 4221-4233.
  • Schafer, W.E. et al., 1995, Genomics. 25: 638-643.
  • Landar, A. et al., 1996, Cell. Calcium. 20: 279-285.
  • TOP