Human PDE1C Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGF697-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1905bp
Gene Synonym
Hcam3, PDE1C
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human phosphodiesterase 1C, calmodulin-dependent 70kDa Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
PDE1C belongs to the cyclic nucleotide phosphodiesterase family, PDE1 subfamily. Phosphodiesterases (PDEs) are a family of related phosphohydrolyases that selectively catalyze the hydrolysis of 3' cyclic phosphate bonds in adenosine and/or guanine 3',5' cyclic monophosphate (cAMP and/or cGMP). They regulate the cellular levels, localization and duration of action of these second messengers by controlling the rate of their degradation. PDEs are expressed ubiquitously, with each subtype having a specific tissue distribution. These enzymes are involved in many signal transduction pathways and their functions include vascular smooth muscle proliferation and contraction, cardiac contractility, platelet aggregation, hormone secretion, immune cell activation, and they are involved in learning and memory. PDE1C has a high affinity for both cAMP and cGMP. It is expressed in several tissues, including brain and heart. As a cyclic nucleotide phosphodiesterase, PDE1C has a dual-specificity for the second messengers cAMP and cGMP.
References
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Dolci S, et al. (2006) Subcellular localization and regulation of type-1C and type-5 phosphodiesterases. Biochem Biophys Res Commun. 341(3):837-46.
  • Vandeput F, et al.. (2007) Cyclic nucleotide phosphodiesterase PDE1C1 in human cardiac myocytes. Biochemistry. J Biol Chem. 282(45):32749-57.
  • TOP