Human PDE1C Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

BC022479

RefSeq ORF Size

1905bp

Gene Synonym

Hcam3, PDE1C

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human phosphodiesterase 1C, calmodulin-dependent 70kDa Gene ORF cDNA clone expression plasmid,C terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PDE1C belongs to the cyclic nucleotide phosphodiesterase family, PDE1 subfamily. Phosphodiesterases (PDEs) are a family of related phosphohydrolyases that selectively catalyze the hydrolysis of 3' cyclic phosphate bonds in adenosine and/or guanine 3',5' cyclic monophosphate (cAMP and/or cGMP). They regulate the cellular levels, localization and duration of action of these second messengers by controlling the rate of their degradation. PDEs are expressed ubiquitously, with each subtype having a specific tissue distribution. These enzymes are involved in many signal transduction pathways and their functions include vascular smooth muscle proliferation and contraction, cardiac contractility, platelet aggregation, hormone secretion, immune cell activation, and they are involved in learning and memory. PDE1C has a high affinity for both cAMP and cGMP. It is expressed in several tissues, including brain and heart. As a cyclic nucleotide phosphodiesterase, PDE1C has a dual-specificity for the second messengers cAMP and cGMP.

References

Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Dolci S, et al. (2006) Subcellular localization and regulation of type-1C and type-5 phosphodiesterases. Biochem Biophys Res Commun. 341(3):837-46.

Vandeput F, et al.. (2007) Cyclic nucleotide phosphodiesterase PDE1C1 in human cardiac myocytes. Biochemistry. J Biol Chem. 282(45):32749-57.

Catalog Number:HGF697-CM