Human PDE1C Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

BC022479

RefSeq ORF Size

1905bp

Gene Synonym

Hcam3, PDE1C

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human phosphodiesterase 1C, calmodulin-dependent 70kDa Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

PDE1C belongs to the cyclic nucleotide phosphodiesterase family, PDE1 subfamily. Phosphodiesterases (PDEs) are a family of related phosphohydrolyases that selectively catalyze the hydrolysis of 3' cyclic phosphate bonds in adenosine and/or guanine 3',5' cyclic monophosphate (cAMP and/or cGMP). They regulate the cellular levels, localization and duration of action of these second messengers by controlling the rate of their degradation. PDEs are expressed ubiquitously, with each subtype having a specific tissue distribution. These enzymes are involved in many signal transduction pathways and their functions include vascular smooth muscle proliferation and contraction, cardiac contractility, platelet aggregation, hormone secretion, immune cell activation, and they are involved in learning and memory. PDE1C has a high affinity for both cAMP and cGMP. It is expressed in several tissues, including brain and heart. As a cyclic nucleotide phosphodiesterase, PDE1C has a dual-specificity for the second messengers cAMP and cGMP.

References

Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.

Dolci S, et al. (2006) Subcellular localization and regulation of type-1C and type-5 phosphodiesterases. Biochem Biophys Res Commun. 341(3):837-46.

Vandeput F, et al.. (2007) Cyclic nucleotide phosphodiesterase PDE1C1 in human cardiac myocytes. Biochemistry. J Biol Chem. 282(45):32749-57.

Catalog Number:HGF697-CO