Human PAD4/PADI4 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGF586-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
2037 bp
Gene Synonym
PAD,PAD4,PADI5,PDI4,PDI5
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human peptidyl arginine deiminase, type I V Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
KpnI + XbaI(6kb+2.04kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Protein-arginine deiminase type-4, also known as HL-60 PAD, Peptidylarginine deiminase IV, Protein-arginine deiminase type I V and PADI4, is a cytoplasm and nucleus protein which belongs to the protein arginine deiminase family. PADI4 is expressed in CD34+ stem cells in normal tissues, and many more CD34+ cells expressing PADI4 are present in tumour tissues. PADI4 post-translationally converts peptidylarginine to citrulline, a process called citrullination. Studies have demonstrated the high expression of PADI4 in various malignant tumour tissues. PADI4 is also expressed at high levels in the blood of patients with some malignant tumours. Citrullination of histone, cytokeratin, antithrombin and fibronectin have been confirmed to be involved in abnormal apoptosis, high coagulation, and disordered cell proliferation and differentiation, all of which are main features of malignant tumours. PADI4 may play an important role in tumourigenesis. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures.
References
  • Nakashima K. et al.,1999, J. Biol. Chem. 274: 27786-92.
  • Suzuki A. et al., 2003, Nat. Genet. 34:395-402.
  • Nakayama-Hamada M. et al., 2005, Biochem. Biophys. Res. Commun. 327:192-200.
  • Chang, X. et al., 2010, Cancer Cell Int  10:7.
  • TOP