Human PAD4/PADI4 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Human

NCBI Ref Seq

NM_012387.2

RefSeq ORF Size

2037 bp

Gene Synonym

PAD,PAD4,PADI5,PDI4,PDI5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human peptidyl arginine deiminase, type I V Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

KpnI + XbaI(6kb+2.04kb)

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein-arginine deiminase type-4, also known as HL-60 PAD, Peptidylarginine deiminase IV, Protein-arginine deiminase type I V and PADI4, is a cytoplasm and nucleus protein which belongs to the protein arginine deiminase family. PADI4 is expressed in CD34+ stem cells in normal tissues, and many more CD34+ cells expressing PADI4 are present in tumour tissues. PADI4 post-translationally converts peptidylarginine to citrulline, a process called citrullination. Studies have demonstrated the high expression of PADI4 in various malignant tumour tissues. PADI4 is also expressed at high levels in the blood of patients with some malignant tumours. Citrullination of histone, cytokeratin, antithrombin and fibronectin have been confirmed to be involved in abnormal apoptosis, high coagulation, and disordered cell proliferation and differentiation, all of which are main features of malignant tumours. PADI4 may play an important role in tumourigenesis. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures.

References

Nakashima K. et al.,1999, J. Biol. Chem. 274: 27786-92.

Suzuki A. et al., 2003, Nat. Genet. 34:395-402.

Nakayama-Hamada M. et al., 2005, Biochem. Biophys. Res. Commun. 327:192-200.

Chang, X. et al., 2010, Cancer Cell Int 10:7.

Catalog Number:HGF586-NM