Human PAD4/PADI4 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Gene

Species

Human

NCBI Ref Seq

NM_012387.2

RefSeq ORF Size

2037 bp

Gene Synonym

PAD,PAD4,PADI5,PDI4,PDI5

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human peptidyl arginine deiminase, type I V Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-OFPSpark

Restriction Site

KpnI + XbaI(6kb+2.04kb)

Protein Tag

OFPSpark

Tag Sequence

GATAGCACTGAG……CACCTGTTCCAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Protein-arginine deiminase type-4, also known as HL-60 PAD, Peptidylarginine deiminase IV, Protein-arginine deiminase type I V and PADI4, is a cytoplasm and nucleus protein which belongs to the protein arginine deiminase family. PADI4 is expressed in CD34+ stem cells in normal tissues, and many more CD34+ cells expressing PADI4 are present in tumour tissues. PADI4 post-translationally converts peptidylarginine to citrulline, a process called citrullination. Studies have demonstrated the high expression of PADI4 in various malignant tumour tissues. PADI4 is also expressed at high levels in the blood of patients with some malignant tumours. Citrullination of histone, cytokeratin, antithrombin and fibronectin have been confirmed to be involved in abnormal apoptosis, high coagulation, and disordered cell proliferation and differentiation, all of which are main features of malignant tumours. PADI4 may play an important role in tumourigenesis. Genetic variations in PADI4 are a cause of susceptibility to rheumatoid arthritis (RA). It is a systemic inflammatory disease with autoimmune features and a complex genetic component. It primarily affects the joints and is characterized by inflammatory changes in the synovial membranes and articular structures, widespread fibrinoid degeneration of the collagen fibers in mesenchymal tissues, and by atrophy and rarefaction of bony structures.

References

Nakashima K. et al.,1999, J. Biol. Chem. 274: 27786-92.

Suzuki A. et al., 2003, Nat. Genet. 34:395-402.

Nakayama-Hamada M. et al., 2005, Biochem. Biophys. Res. Commun. 327:192-200.

Chang, X. et al., 2010, Cancer Cell Int 10:7.

Catalog Number:HGF586-CO