Human ORP150/HYOU1/HSP12A (Grp170) Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Catalog Number:HGF526-NM

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3000bp
Gene Synonym
Grp170, HSP12A, ORP150, FLJ94899, FLJ97572, DKFZp686N08236, HYOU1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human hypoxia up-regulated 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-Myc
Restriction Site
Protein Tag
Myc
Tag Sequence
GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Hypoxia up-regulated protein 1, also known as 150 kDa oxygen-regulated protein, 170 kDa glucose-regulated protein, ORP-150, GRP-170 and HYOU1, is a member of the heat shock protein 70 family. Seven members from four different heat shock protein (HSP) families were identified including HYOU1 (ORP150), HSPC1 (HSP86), HSPA5 (Bip), HSPD1 (HSP60), and several isoforms of the two testis-specific HSP70 chaperones HSPA2 and HSPA1L. HYOU1 is highly expressed in tissues that contain well-developed endoplasmic reticulum and synthesize large amounts of secretory proteins. It is highly expressed in liver and pancreas. HYOU1 is also expressed in macrophages within aortic atherosclerotic plaques, and in breast cancers. HYOU1 has a pivotal role in cytoprotective cellular mechanisms triggered by oxygen deprivation. It may play a role as a molecular chaperone and participate in protein folding. Suppression of HYOU1 is associated with accelerated apoptosis. It is suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness.
References
TOP