Human ORP150/HYOU1/HSP12A (Grp170) Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGF526-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
3000bp
Gene Synonym
Grp170, HSP12A, ORP150, FLJ94899, FLJ97572, DKFZp686N08236, HYOU1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human hypoxia up-regulated 1 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Hypoxia up-regulated protein 1, also known as 150 kDa oxygen-regulated protein, 170 kDa glucose-regulated protein, ORP-150, GRP-170 and HYOU1, is a member of the heat shock protein 70 family. Seven members from four different heat shock protein (HSP) families were identified including HYOU1 (ORP150), HSPC1 (HSP86), HSPA5 (Bip), HSPD1 (HSP60), and several isoforms of the two testis-specific HSP70 chaperones HSPA2 and HSPA1L. HYOU1 is highly expressed in tissues that contain well-developed endoplasmic reticulum and synthesize large amounts of secretory proteins. It is highly expressed in liver and pancreas. HYOU1 is also expressed in macrophages within aortic atherosclerotic plaques, and in breast cancers. HYOU1 has a pivotal role in cytoprotective cellular mechanisms triggered by oxygen deprivation. It may play a role as a molecular chaperone and participate in protein folding. Suppression of HYOU1 is associated with accelerated apoptosis. It is suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness.
References
TOP