Human ORP150/HYOU1/HSP12A (Grp170) Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_001130991.1

RefSeq ORF Size

3000bp

Gene Synonym

Grp170, HSP12A, ORP150, FLJ94899, FLJ97572, DKFZp686N08236, HYOU1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human hypoxia up-regulated 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Hypoxia up-regulated protein 1, also known as 150 kDa oxygen-regulated protein, 170 kDa glucose-regulated protein, ORP-150, GRP-170 and HYOU1, is a member of the heat shock protein 70 family. Seven members from four different heat shock protein (HSP) families were identified including HYOU1 (ORP150), HSPC1 (HSP86), HSPA5 (Bip), HSPD1 (HSP60), and several isoforms of the two testis-specific HSP70 chaperones HSPA2 and HSPA1L. HYOU1 is highly expressed in tissues that contain well-developed endoplasmic reticulum and synthesize large amounts of secretory proteins. It is highly expressed in liver and pancreas. HYOU1 is also expressed in macrophages within aortic atherosclerotic plaques, and in breast cancers. HYOU1 has a pivotal role in cytoprotective cellular mechanisms triggered by oxygen deprivation. It may play a role as a molecular chaperone and participate in protein folding. Suppression of HYOU1 is associated with accelerated apoptosis. It is suggested to have an important cytoprotective role in hypoxia-induced cellular perturbation. This protein has been shown to be up-regulated in tumors, especially in breast tumors, and thus it is associated with tumor invasiveness.

References

Catalog Number:HGF526-CY