Human Moesin Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

BC017293

RefSeq ORF Size

1734bp

Gene Synonym

MSN

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human moesin Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Moesin is a member of the ERM family which includes ezrin and radixin. ERM proteins, highly related members of the larger protein 4.1 superfamily, can exist in an active or inactive conformation. It seems that ERM proteins function as cross-linkers between plasma membranes and actin-based cytoskeletons. The sole Drosophila ERM protein, moesin, functions to promote cortical actin assembly and apical-basal polarity. As a result, cells lacking moesin lose epithelial characteristics and adopt invasive migratory behaviour. It is localized to filopodia and other membranous protrusions that are important for cell-cell recognition and signaling and for cell movement. Moesin contains 1 FERM domain and is expressed in all tissues and cultured cells studied. Moesin has been shown to interact with CD43, Neutrophil cytosolic factor 1, VCAM-1, Neutrophil cytosolic factor 4, ICAM3 and EZR.

References

Lankes WT, et al. (1991) Moesin: a member of the protein 4.1-talin-ezrin family of proteins. Proc Natl Acad Sci. 88(19):8297-301.

Serrador, J M, et al. (1998) CD43 interacts with moesin and ezrin and regulates its redistribution to the uropods of T lymphocytes at the cell-cell contacts. Blood. 91(12):4632-44.

Barreiro Olga, et al. (2002) Dynamic interaction of VCAM-1 and ICAM-1 with moesin and ezrin in a novel endothelial docking structure for adherent leukocytes. J Cell Biol. 157(7):1233-45.

Catalog Number:HGE917-CY