Human Moesin Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Catalog Number:HGE917-CF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1734bp
Gene Synonym
MSN
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human moesin Gene ORF cDNA clone expression plasmid,C terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Moesin is a member of the ERM family which includes ezrin and radixin. ERM proteins, highly related members of the larger protein 4.1 superfamily, can exist in an active or inactive conformation. It seems that ERM proteins function as cross-linkers between plasma membranes and actin-based cytoskeletons. The sole Drosophila ERM protein, moesin, functions to promote cortical actin assembly and apical-basal polarity. As a result, cells lacking moesin lose epithelial characteristics and adopt invasive migratory behaviour. It is localized to filopodia and other membranous protrusions that are important for cell-cell recognition and signaling and for cell movement. Moesin contains 1 FERM domain and is expressed in all tissues and cultured cells studied. Moesin has been shown to interact with CD43, Neutrophil cytosolic factor 1, VCAM-1, Neutrophil cytosolic factor 4, ICAM3 and EZR.
References
  • Lankes WT, et al. (1991) Moesin: a member of the protein 4.1-talin-ezrin family of proteins. Proc Natl Acad Sci. 88(19):8297-301.
  • Serrador, J M, et al. (1998) CD43 interacts with moesin and ezrin and regulates its redistribution to the uropods of T lymphocytes at the cell-cell contacts. Blood. 91(12):4632-44.
  • Barreiro Olga, et al. (2002) Dynamic interaction of VCAM-1 and ICAM-1 with moesin and ezrin in a novel endothelial docking structure for adherent leukocytes. J Cell Biol. 157(7):1233-45.
  • TOP