Human Moesin Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGE917-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1734bp
Gene Synonym
MSN
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human moesin Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Moesin is a member of the ERM family which includes ezrin and radixin. ERM proteins, highly related members of the larger protein 4.1 superfamily, can exist in an active or inactive conformation. It seems that ERM proteins function as cross-linkers between plasma membranes and actin-based cytoskeletons. The sole Drosophila ERM protein, moesin, functions to promote cortical actin assembly and apical-basal polarity. As a result, cells lacking moesin lose epithelial characteristics and adopt invasive migratory behaviour. It is localized to filopodia and other membranous protrusions that are important for cell-cell recognition and signaling and for cell movement. Moesin contains 1 FERM domain and is expressed in all tissues and cultured cells studied. Moesin has been shown to interact with CD43, Neutrophil cytosolic factor 1, VCAM-1, Neutrophil cytosolic factor 4, ICAM3 and EZR.
References
  • Lankes WT, et al. (1991) Moesin: a member of the protein 4.1-talin-ezrin family of proteins. Proc Natl Acad Sci. 88(19):8297-301.
  • Serrador, J M, et al. (1998) CD43 interacts with moesin and ezrin and regulates its redistribution to the uropods of T lymphocytes at the cell-cell contacts. Blood. 91(12):4632-44.
  • Barreiro Olga, et al. (2002) Dynamic interaction of VCAM-1 and ICAM-1 with moesin and ezrin in a novel endothelial docking structure for adherent leukocytes. J Cell Biol. 157(7):1233-45.
  • TOP