Mouse LIMP-2/SCARB2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGE370-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1527 bp
Gene Synonym
LGP85, Cd36l2, LIMP-2, MLGP85, 9330185J12Rik, Scarb2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse scavenger receptor class B, member 2 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
KpnI + XbaI(6kb+1.53kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lysosomal Integral Membrane Protein II (LIMPII), also known as SCARB2, LPG85, and CD36L2, is a type I II multi-pass membrane glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes on all tissues and cell types so far examined. This protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. LIMPII is identified as a receptor for EV71 (human enterovirus species A, Enterovirus 71) and CVA16 (coxsackievirus A16) which are most frequently associated with hand, foot and mouth disease (HFMD). Expression of human LIMPII enables normally unsusceptible cell lines to support the viruses’ propagation and develop cytopathic effects. In addition, LIMPII also has been shown to bind thrombospondin-1, may contribute to the pro-adhesive changes of activated platelets during coagulation, and inflammation. Deficiency of the protein in mice impairs cell membrane transport processes and causes pelvic junction obstruction, deafness, and peripheral neuropathy.
References
  • Crombie, R. et al., 1998, J. Biol. Chem. 273: 4855-4863.
  • Febbraio, M. et al., 2001, J. Clin. Invest. 108: 785-791.
  • Kuronita, T. et al., 2002, J. Cell Sci. 115: 4117-4131.
  • Gamp, A.C. et al., 2003, Human Molecular Genetics. 12: 631-646.
  • Eskelinen, E.L. et al., 2003, Trends in Cell Biology. 13: 137-145.
  • Mulcahy, J.V. et al.,2004, Biochem. J. 377 (Pt 3): 741–747.
  • Yamayoshi, S. et al., 2009, Nat Med. 15 (7): 798-801.
  • TOP