Mouse LIMP-2/SCARB2 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Gene

Species

Mouse

NCBI Ref Seq

NM_007644.3

RefSeq ORF Size

1527 bp

Gene Synonym

LGP85, Cd36l2, LIMP-2, MLGP85, 9330185J12Rik, Scarb2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse scavenger receptor class B, member 2 Gene ORF cDNA clone expression plasmid,C terminal GFP tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-GFPSpark

Restriction Site

KpnI + XbaI(6kb+1.53kb)

Protein Tag

GFPSpark

Tag Sequence

GTGAGCAAGGGC……GAGCTGTACAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

GFPSpark Tag Information

GFPSpark is an improved variant of the green fluorescent protein GFP. It possesses bright green fluorescence (excitation/ emission max = 487 / 508 nm) that is visible earlier than fluorescence of other green fluorescent proteins. GFPSpark is mainly intended for applications where fast appearance of bright fluorescence is crucial. It is specially recommended for cell and organelle labeling and tracking the promoter activity.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Lysosomal Integral Membrane Protein II (LIMPII), also known as SCARB2, LPG85, and CD36L2, is a type I II multi-pass membrane glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes on all tissues and cell types so far examined. This protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. LIMPII is identified as a receptor for EV71 (human enterovirus species A, Enterovirus 71) and CVA16 (coxsackievirus A16) which are most frequently associated with hand, foot and mouth disease (HFMD). Expression of human LIMPII enables normally unsusceptible cell lines to support the viruses’ propagation and develop cytopathic effects. In addition, LIMPII also has been shown to bind thrombospondin-1, may contribute to the pro-adhesive changes of activated platelets during coagulation, and inflammation. Deficiency of the protein in mice impairs cell membrane transport processes and causes pelvic junction obstruction, deafness, and peripheral neuropathy.

References

Crombie, R. et al., 1998, J. Biol. Chem. 273: 4855-4863.

Febbraio, M. et al., 2001, J. Clin. Invest. 108: 785-791.

Kuronita, T. et al., 2002, J. Cell Sci. 115: 4117-4131.

Gamp, A.C. et al., 2003, Human Molecular Genetics. 12: 631-646.

Eskelinen, E.L. et al., 2003, Trends in Cell Biology. 13: 137-145.

Mulcahy, J.V. et al.,2004, Biochem. J. 377 (Pt 3): 741–747.

Yamayoshi, S. et al., 2009, Nat Med. 15 (7): 798-801.

Catalog Number:HGE370-CG