Mouse LIMP-2/SCARB2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGE370-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1527 bp
Gene Synonym
LGP85, Cd36l2, LIMP-2, MLGP85, 9330185J12Rik, Scarb2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse scavenger receptor class B, member 2 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
KpnI + XbaI(6kb+1.53kb)
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Lysosomal Integral Membrane Protein II (LIMPII), also known as SCARB2, LPG85, and CD36L2, is a type I II multi-pass membrane glycoprotein that is located primarily in limiting membranes of lysosomes and endosomes on all tissues and cell types so far examined. This protein may participate in membrane transportation and the reorganization of endosomal/lysosomal compartment. LIMPII is identified as a receptor for EV71 (human enterovirus species A, Enterovirus 71) and CVA16 (coxsackievirus A16) which are most frequently associated with hand, foot and mouth disease (HFMD). Expression of human LIMPII enables normally unsusceptible cell lines to support the viruses’ propagation and develop cytopathic effects. In addition, LIMPII also has been shown to bind thrombospondin-1, may contribute to the pro-adhesive changes of activated platelets during coagulation, and inflammation. Deficiency of the protein in mice impairs cell membrane transport processes and causes pelvic junction obstruction, deafness, and peripheral neuropathy.
References
  • Crombie, R. et al., 1998, J. Biol. Chem. 273: 4855-4863.
  • Febbraio, M. et al., 2001, J. Clin. Invest. 108: 785-791.
  • Kuronita, T. et al., 2002, J. Cell Sci. 115: 4117-4131.
  • Gamp, A.C. et al., 2003, Human Molecular Genetics. 12: 631-646.
  • Eskelinen, E.L. et al., 2003, Trends in Cell Biology. 13: 137-145.
  • Mulcahy, J.V. et al.,2004, Biochem. J. 377 (Pt 3): 741–747.
  • Yamayoshi, S. et al., 2009, Nat Med. 15 (7): 798-801.
  • TOP