Mouse FGFRL1 / FGFR5 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Gene

Species

Mouse

NCBI Ref Seq

NM_054071.1

RefSeq ORF Size

1590bp

Gene Synonym

FGFR5, FGFR5beta, FGFR5gamma, Fgfrl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse fibroblast growth factor receptor-like 1 Gene ORF cDNA clone expression plasmid,N terminal Myc tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-Myc

Restriction Site

Protein Tag

Myc

Tag Sequence

GAGCAGAAACTCATCTCAGAAGAGGATCTG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Myc Tag Information

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Fibroblast growth factor receptor-like 1 (FGFRL1) also known as Fibroblast growth factor receptor 5 (FGFR5), is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A unique feature of FGFRL1/FGFR5 is that it does not contain an intracellular tyrosine kinase domain. Some muscle types, including the muscles of the tongue and the diaphragm, express FGFRL1/FGFR5 at relatively high level. In contrast, the heart and the skeletal muscles of the limbs, as well as many other organs (brain, lung, liver, kidney, gut) express Fgfrl1 only at basal level. It is conceivable that FGFRL1/FGFR5 interacts with other Fgfrs, which are expressed in cartilage and muscle, to modulate FGF signaling.

References

Wiedemann M, et al. (2000) Characterization of a novel protein (FGFRL1) from human cartilage related to FGF receptors. Genomics. 69(2): 275-9.

Trueb B, et al. (2006) Expression of FGFRL1, a novel fibroblast growth factor receptor, during embryonic development. Int J Mol Med. 17(4): 617-20.

Wiedemann M, et al. (2001) The mouse Fgfrl1 gene coding for a novel FGF receptor-like protein. Biochim Biophys Acta. 1520(3): 247-50.

Trueb B, et al. (2003) Characterization of FGFRL1, a novel fibroblast growth factor (FGF) receptor preferentially expressed in skeletal tissues. J Biol Chem. 278(36): 33857-65.

Catalog Number:HGC823-NM