Mouse FGFRL1 / FGFR5 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Mouse

NCBI Ref Seq

NM_054071.1

RefSeq ORF Size

1590bp

Gene Synonym

FGFR5, FGFR5beta, FGFR5gamma, Fgfrl1

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse fibroblast growth factor receptor-like 1 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Fibroblast growth factor receptor-like 1 (FGFRL1) also known as Fibroblast growth factor receptor 5 (FGFR5), is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A unique feature of FGFRL1/FGFR5 is that it does not contain an intracellular tyrosine kinase domain. Some muscle types, including the muscles of the tongue and the diaphragm, express FGFRL1/FGFR5 at relatively high level. In contrast, the heart and the skeletal muscles of the limbs, as well as many other organs (brain, lung, liver, kidney, gut) express Fgfrl1 only at basal level. It is conceivable that FGFRL1/FGFR5 interacts with other Fgfrs, which are expressed in cartilage and muscle, to modulate FGF signaling.

References

Wiedemann M, et al. (2000) Characterization of a novel protein (FGFRL1) from human cartilage related to FGF receptors. Genomics. 69(2): 275-9.

Trueb B, et al. (2006) Expression of FGFRL1, a novel fibroblast growth factor receptor, during embryonic development. Int J Mol Med. 17(4): 617-20.

Wiedemann M, et al. (2001) The mouse Fgfrl1 gene coding for a novel FGF receptor-like protein. Biochim Biophys Acta. 1520(3): 247-50.

Trueb B, et al. (2003) Characterization of FGFRL1, a novel fibroblast growth factor (FGF) receptor preferentially expressed in skeletal tissues. J Biol Chem. 278(36): 33857-65.

Catalog Number:HGC823-CY