Mouse FGFRL1 / FGFR5 Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGC823-CO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1590bp
Gene Synonym
FGFR5, FGFR5beta, FGFR5gamma, Fgfrl1
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse fibroblast growth factor receptor-like 1 Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fibroblast growth factor receptor-like 1 (FGFRL1) also known as Fibroblast growth factor receptor 5 (FGFR5), is a member of the fibroblast growth factor receptor (FGFR) family, where amino acid sequence is highly conserved between members and throughout evolution. A full-length representative protein would consist of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. A unique feature of FGFRL1/FGFR5 is that it does not contain an intracellular tyrosine kinase domain. Some muscle types, including the muscles of the tongue and the diaphragm, express FGFRL1/FGFR5 at relatively high level. In contrast, the heart and the skeletal muscles of the limbs, as well as many other organs (brain, lung, liver, kidney, gut) express Fgfrl1 only at basal level. It is conceivable that FGFRL1/FGFR5 interacts with other Fgfrs, which are expressed in cartilage and muscle, to modulate FGF signaling.
References
  • Wiedemann M, et al. (2000) Characterization of a novel protein (FGFRL1) from human cartilage related to FGF receptors. Genomics. 69(2): 275-9.
  • Trueb B, et al. (2006) Expression of FGFRL1, a novel fibroblast growth factor receptor, during embryonic development. Int J Mol Med. 17(4): 617-20.
  • Wiedemann M, et al. (2001) The mouse Fgfrl1 gene coding for a novel FGF receptor-like protein. Biochim Biophys Acta. 1520(3): 247-50.
  • Trueb B, et al. (2003) Characterization of FGFRL1, a novel fibroblast growth factor (FGF) receptor preferentially expressed in skeletal tissues. J Biol Chem. 278(36): 33857-65.
  • TOP