Human FGFBP3 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGC818-NO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
777bp
Gene Synonym
FGF-BP3, C10orf13, MGC39320
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor binding protein 3 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FGFBP3 is a member of the fibroblast growth factor-binding protein family. Members of this family binds and activates FGF-1 and FGF-2, thereby contributing to tumor angiogenesis. Fibroblast growth factors (FGFs) are important regulators of cell migration, proliferation and differentiation, e.g., during embryogenesis and wound healing, and under several pathological conditions including tumor growth and tumor angiogenesis. Expression of FGF-BP increases after injury to murine and human skin, in particular in keratinocytes. This upregulation is most likely achieved by major keratinocyte mitogens present at the wound site. FGFBP3 is a positive regulator of fibroblast growth factor receptor signaling pathway and vascular permeability. It interacts with 2,3,7,8-tetrachlorodibenzodioxine, benzopyrene and valproic acid. FGFBP3 also exhibits fibroblast growth factor binding (orthology) and heparin binding (orthology).
References
  • Abuharbeid S, et al. (2006) The fibroblast growth factor-binding protein FGF-BP. Int J Biochem Cell Biol. 38(9):1463-8.
  • Lange LG, et al. (1976) Human liver alcohol dehydrogenase: purification, composition, and catalytic features. Biochemistry. 15(21):4687-93.
  • Czubayko F, et al. (1997) A secreted FGF-binding protein can serve as the angiogenic switch in human cancer. Nat Med. 3(10):1137-40.
  • TOP