Human FGFBP3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Catalog Number:HGC818-NF

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
777bp
Gene Synonym
FGF-BP3, C10orf13, MGC39320
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fibroblast growth factor binding protein 3 Gene ORF cDNA clone expression plasmid,N terminal Flag tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-FLAG
Restriction Site
Protein Tag
Flag
Tag Sequence
GATTACAAGGATGACGACGATAAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
FGFBP3 is a member of the fibroblast growth factor-binding protein family. Members of this family binds and activates FGF-1 and FGF-2, thereby contributing to tumor angiogenesis. Fibroblast growth factors (FGFs) are important regulators of cell migration, proliferation and differentiation, e.g., during embryogenesis and wound healing, and under several pathological conditions including tumor growth and tumor angiogenesis. Expression of FGF-BP increases after injury to murine and human skin, in particular in keratinocytes. This upregulation is most likely achieved by major keratinocyte mitogens present at the wound site. FGFBP3 is a positive regulator of fibroblast growth factor receptor signaling pathway and vascular permeability. It interacts with 2,3,7,8-tetrachlorodibenzodioxine, benzopyrene and valproic acid. FGFBP3 also exhibits fibroblast growth factor binding (orthology) and heparin binding (orthology).
References
  • Abuharbeid S, et al. (2006) The fibroblast growth factor-binding protein FGF-BP. Int J Biochem Cell Biol. 38(9):1463-8.
  • Lange LG, et al. (1976) Human liver alcohol dehydrogenase: purification, composition, and catalytic features. Biochemistry. 15(21):4687-93.
  • Czubayko F, et al. (1997) A secreted FGF-binding protein can serve as the angiogenic switch in human cancer. Nat Med. 3(10):1137-40.
  • TOP