Human FGFBP3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Gene

Species

Human

NCBI Ref Seq

NM_152429.4

RefSeq ORF Size

777bp

Gene Synonym

FGF-BP3, C10orf13, MGC39320

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human fibroblast growth factor binding protein 3 Gene ORF cDNA clone expression plasmid,C terminal HA tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-HA

Restriction Site

Protein Tag

HA

Tag Sequence

TATCCTTACGACGTGCCTGACTACGCC

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

FGFBP3 is a member of the fibroblast growth factor-binding protein family. Members of this family binds and activates FGF-1 and FGF-2, thereby contributing to tumor angiogenesis. Fibroblast growth factors (FGFs) are important regulators of cell migration, proliferation and differentiation, e.g., during embryogenesis and wound healing, and under several pathological conditions including tumor growth and tumor angiogenesis. Expression of FGF-BP increases after injury to murine and human skin, in particular in keratinocytes. This upregulation is most likely achieved by major keratinocyte mitogens present at the wound site. FGFBP3 is a positive regulator of fibroblast growth factor receptor signaling pathway and vascular permeability. It interacts with 2,3,7,8-tetrachlorodibenzodioxine, benzopyrene and valproic acid. FGFBP3 also exhibits fibroblast growth factor binding (orthology) and heparin binding (orthology).

References

Abuharbeid S, et al. (2006) The fibroblast growth factor-binding protein FGF-BP. Int J Biochem Cell Biol. 38(9):1463-8.

Lange LG, et al. (1976) Human liver alcohol dehydrogenase: purification, composition, and catalytic features. Biochemistry. 15(21):4687-93.

Czubayko F, et al. (1997) A secreted FGF-binding protein can serve as the angiogenic switch in human cancer. Nat Med. 3(10):1137-40.

Catalog Number:HGC818-CY