Human FABP2 / I-FABP Gene ORF cDNA clone expression plasmid,C terminal OFP tag

Catalog Number:HGC637-CO

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
399bp
Gene Synonym
FABPI, I-FABP, MGC133132, FABP2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human fatty acid binding protein 2, intestinal (FABP2) Gene ORF cDNA clone expression plasmid,C terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-C-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Fatty acid binding protein (FABP) is one of the intracellular proteins, with a low molecular weight of approximately 15 kDa, that plays important roles in the transportation and metabolism of long-chain fatty acids. FABP family proteins could be used as tissue specific injury marker based on the following characteristics of FABP. The intestinal fatty acid binding protein (I-FABP), or fatty acid-binding protein 2 (FABP2), an intracellular protein expressed only in the intestine, involved in the absorption and intracellular transport of dietary long chain fatty acids. The FABP2 gene is proposed as a candidate gene for diabetes because the protein it codes is involved in fatty acid (FA) absorption and metabolism. Numerous studies have assessed FABP2 gene variants. A transition of G to A at codon 54 of FABP2 results in an amino acid substitution (Ala54 to Thr54), which is common in diverse populations and results in increased FA absorption in vivo. Some evidence indicates that this variant may be associated with type 2 diabetes. This polymorphism was associated with some cardiovascular risk factors. The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. FABP2 may also help maintain energy homeostasis by functioning as a lipid sensor.
References
  • de Luis DA, et al. (2007) Influence of ALA54THR polymorphism of fatty acid-binding protein 2 on obesity and cardiovascular risk factors. Horm Metab Res. 39(11): 830-4.
  • Klapper M, et al.. (2007) The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4alpha. Biochem Biophys Res Commun. 356(1): 147-52.
  • TOP