Human FABP2 / I-FABP Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Gene

Species

Human

NCBI Ref Seq

NM_000134.3

RefSeq ORF Size

399bp

Gene Synonym

FABPI, I-FABP, MGC133132, FABP2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Human fatty acid binding protein 2, intestinal (FABP2) Gene ORF cDNA clone expression plasmid,C terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-C-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Fatty acid binding protein (FABP) is one of the intracellular proteins, with a low molecular weight of approximately 15 kDa, that plays important roles in the transportation and metabolism of long-chain fatty acids. FABP family proteins could be used as tissue specific injury marker based on the following characteristics of FABP. The intestinal fatty acid binding protein (I-FABP), or fatty acid-binding protein 2 (FABP2), an intracellular protein expressed only in the intestine, involved in the absorption and intracellular transport of dietary long chain fatty acids. The FABP2 gene is proposed as a candidate gene for diabetes because the protein it codes is involved in fatty acid (FA) absorption and metabolism. Numerous studies have assessed FABP2 gene variants. A transition of G to A at codon 54 of FABP2 results in an amino acid substitution (Ala54 to Thr54), which is common in diverse populations and results in increased FA absorption in vivo. Some evidence indicates that this variant may be associated with type 2 diabetes. This polymorphism was associated with some cardiovascular risk factors. The cytosolic human intestinal fatty acid binding protein (hFABP2) is proposed to be involved in intestinal absorption of long-chain fatty acids. FABP2 may also help maintain energy homeostasis by functioning as a lipid sensor.

References

de Luis DA, et al. (2007) Influence of ALA54THR polymorphism of fatty acid-binding protein 2 on obesity and cardiovascular risk factors. Horm Metab Res. 39(11): 830-4.

Klapper M, et al.. (2007) The human intestinal fatty acid binding protein (hFABP2) gene is regulated by HNF-4alpha. Biochem Biophys Res Commun. 356(1): 147-52.

Catalog Number:HGC637-CF