Mouse EphA2/Eph Receptor A2 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGC537-NY

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2934bp
Gene Synonym
Eck, Myk2, Sek2, Sek-2, AW545284, Epha2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Eph receptor A2 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. The Eph receptors' corresponding family of ligands are the ephrins anchored to cell surfaces. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps. They have also been found implicated in embryonic patterning, neuronal targeting, vascular development and adult neovascularization. The large family of ligands and receptors may make a major contribution to the accurate spatial patterning of connections and cell position in the nervous system. Furthermore, elevated expression of Eph receptors and ephrin ligands is associated with tumors and associated tumor vasculature, suggesting the Eph receptors and ephrin ligands also play critical roles in tumor angiogenesis and tumor growth. Unlike most Eph kinases, which are primarily expressed during development, EphA2 is primarily found in adult human epithelial cells. The cellular functions of EphA2 may be regulating cell growth, survival, migration, and angiogenesis.Unlike other receptor tyrosine kinases, ligand binding is not necessary for EphA2. Rather, the ligand appears to regulate EphA2 subcellular localization and its interactions with downstream adapter and signaling proteins. Eph receptor A2(EphA2) has been demonstrated to critically regulate tumor cell growth, migration and invasiveness. Eph receptor A2(EphA2) is frequently overexpressed and functionally altered in aggressive tumor cells, and that these changes promote metastatic character.
References
  • Flanagan JG, et al. (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 21: 309-45.
  • Cheng N, et al. (2002) The ephrins and Eph receptors in angiogenesis. Cytokine Growth Factor Rev. 13(1): 75-85.
  • Pratt RL, et al. (2002) Activation of the EphA2 tyrosine kinase stimulates the MAP/ERK kinase signaling cascade. Oncogene. 21(50): 7690-9.
  • Jennifer Walker-Daniels, et al. (2003) Differential Regulation of EphA2 in Normal and Malignant Cells. Am J Pathol. 162(4): 1037-1042.
  • TOP