Mouse EphA2/Eph Receptor A2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Gene

Species

Mouse

NCBI Ref Seq

NM_010139.2

RefSeq ORF Size

2934bp

Gene Synonym

Eck, Myk2, Sek2, Sek-2, AW545284, Epha2

Sequence Description

Identical with the Gene Bank Ref. ID sequence.

Description

Full length Clone DNA of Mouse Eph receptor A2 Gene ORF cDNA clone expression plasmid,N terminal Flag tag

Plasmid

Promoter

Enhanced CMV mammalian cell promoter

Vector

pCMV3-N-FLAG

Restriction Site

Protein Tag

Flag

Tag Sequence

GATTACAAGGATGACGACGATAAG

Sequencing Primers

Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)

Quality Control

The plasmid is confirmed by full-length sequencing.

Flag Tag Information

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Screening

Antibiotic in E.coli

Kanamycin

Antibiotic in Mammalian cell

Hygromycin

Application

Stable or Transient mammalian expression

Storage & Shipping

Shipping

Each tube contains lyophilized plasmid.

Storage

The lyophilized plasmid can be stored at ambient temperature for three months.

Other Life Science vendor

Natural small molecules manufacturer | Biological Research Reagents Manufacturer

Background Information

Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. The Eph receptors' corresponding family of ligands are the ephrins anchored to cell surfaces. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps. They have also been found implicated in embryonic patterning, neuronal targeting, vascular development and adult neovascularization. The large family of ligands and receptors may make a major contribution to the accurate spatial patterning of connections and cell position in the nervous system. Furthermore, elevated expression of Eph receptors and ephrin ligands is associated with tumors and associated tumor vasculature, suggesting the Eph receptors and ephrin ligands also play critical roles in tumor angiogenesis and tumor growth. Unlike most Eph kinases, which are primarily expressed during development, EphA2 is primarily found in adult human epithelial cells. The cellular functions of EphA2 may be regulating cell growth, survival, migration, and angiogenesis.Unlike other receptor tyrosine kinases, ligand binding is not necessary for EphA2. Rather, the ligand appears to regulate EphA2 subcellular localization and its interactions with downstream adapter and signaling proteins. Eph receptor A2(EphA2) has been demonstrated to critically regulate tumor cell growth, migration and invasiveness. Eph receptor A2(EphA2) is frequently overexpressed and functionally altered in aggressive tumor cells, and that these changes promote metastatic character.

References

Flanagan JG, et al. (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 21: 309-45.

Cheng N, et al. (2002) The ephrins and Eph receptors in angiogenesis. Cytokine Growth Factor Rev. 13(1): 75-85.

Pratt RL, et al. (2002) Activation of the EphA2 tyrosine kinase stimulates the MAP/ERK kinase signaling cascade. Oncogene. 21(50): 7690-9.

Jennifer Walker-Daniels, et al. (2003) Differential Regulation of EphA2 in Normal and Malignant Cells. Am J Pathol. 162(4): 1037-1042.

Catalog Number:HGC537-NF