Mouse EphA2/Eph Receptor A2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag

Catalog Number:HGC537-NO

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2934bp
Gene Synonym
Eck, Myk2, Sek2, Sek-2, AW545284, Epha2
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse Eph receptor A2 Gene ORF cDNA clone expression plasmid,N terminal OFP tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-OFPSpark
Restriction Site
Protein Tag
OFPSpark
Tag Sequence
GATAGCACTGAG……CACCTGTTCCAG
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
OFPSpark Tag Information

OFPSpark is a red (orange) fluorescent protein (excitation/emission maxima are 549 and 566 nm, respectively) derived from DsRed. Possessing high photostability and pH stability, OFPSpark is more than twice brighter than mOrange2. Fast OFPSpark maturation makes it clearly detectable in mammalian cells as early as within 8 hrs after transfection. OFPSpark can be expressed and detected in a wide range of organisms. Mammalian cells transiently transfected with OFPSpark expression vectors produce bright fluorescence in 8 hrs after transfection. No cytotoxic effects or visible protein aggregation are observed. For its monomer structure, OFPSpark performs well in some fusions and protein labeling applications.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Eph receptor A2 (Ephrin type-A receptor 2 or EphA2) is a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. The Eph receptors' corresponding family of ligands are the ephrins anchored to cell surfaces. The ephrins and Eph receptors are implicated as positional labels that may guide the development of neural topographic maps. They have also been found implicated in embryonic patterning, neuronal targeting, vascular development and adult neovascularization. The large family of ligands and receptors may make a major contribution to the accurate spatial patterning of connections and cell position in the nervous system. Furthermore, elevated expression of Eph receptors and ephrin ligands is associated with tumors and associated tumor vasculature, suggesting the Eph receptors and ephrin ligands also play critical roles in tumor angiogenesis and tumor growth. Unlike most Eph kinases, which are primarily expressed during development, EphA2 is primarily found in adult human epithelial cells. The cellular functions of EphA2 may be regulating cell growth, survival, migration, and angiogenesis.Unlike other receptor tyrosine kinases, ligand binding is not necessary for EphA2. Rather, the ligand appears to regulate EphA2 subcellular localization and its interactions with downstream adapter and signaling proteins. Eph receptor A2(EphA2) has been demonstrated to critically regulate tumor cell growth, migration and invasiveness. Eph receptor A2(EphA2) is frequently overexpressed and functionally altered in aggressive tumor cells, and that these changes promote metastatic character.
References
  • Flanagan JG, et al. (1998) The ephrins and Eph receptors in neural development. Annu Rev Neurosci. 21: 309-45.
  • Cheng N, et al. (2002) The ephrins and Eph receptors in angiogenesis. Cytokine Growth Factor Rev. 13(1): 75-85.
  • Pratt RL, et al. (2002) Activation of the EphA2 tyrosine kinase stimulates the MAP/ERK kinase signaling cascade. Oncogene. 21(50): 7690-9.
  • Jennifer Walker-Daniels, et al. (2003) Differential Regulation of EphA2 in Normal and Malignant Cells. Am J Pathol. 162(4): 1037-1042.
  • TOP