Human DUSP14 / MKP-6 Gene ORF cDNA clone expression plasmid,N terminal HA tag

Catalog Number:HGC323-NY

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
642 bp
Gene Synonym
MKP6; MKP-L
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human dual specificity phosphatase 14 Gene ORF cDNA clone expression plasmid,N terminal HA tag
Plasmid
Promoter
Enhanced CMV mammalian cell promoter
Vector
pCMV3-N-HA
Restriction Site
KpnI + XbaI(6kb+0.64kb)
Protein Tag
HA
Tag Sequence
TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
Forward:T7(TAATACGACTCACTATAGGG) Reverse:BGH(TAGAAGGCACAGTCGAGG)
Quality Control
The plasmid is confirmed by full-length sequencing.
HA Tag Information

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Background Information
Dual specific phosphatase 14 / MAP-kinase phophatase-6 (DUSP14 / MKP6) is a member of Dual-specificity phosphatases that is a subclass of protein tyrosine phosphatases (PTP) families that can dephosphorylate bothe phosphotyrosine and phosphoserine / phosphothreonine residues in substrates. Unlike many other DUSPs, DUSP14 only contains a catalytic domain within the C-terminal region. In signal transduction, DUSP14 has been considered as negative regulator of the mitogen-activated protein kinase (MAPK) / extracellular signal-regulated kinase 1 / 2 (ERK 1 / 2) pathway. DUSP14 phosphatase activity has been confirmed to be inhibited by PTP inhibitor Ⅳ. PTP inhibitor binds to the catalytic site of DUSP14. PTP inhibitor Ⅳ effectively and specifically inhibited DUSP14-mediated dephosphorylation of JNK, a member of the mitogen-activated protein kinase (MAPK) family through dephosphorylation of both the Ser / Thr and Tyr residues of MAPKs. 
References
  • Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.
  • Klinger S, et al. (2008) Increasing GLP-1-induced beta-cell proliferation by silencing the negative regulators of signaling cAMP response element modulator-alpha and DUSP14. Diabetes. 57 (3): 584-93.
  • Park JE, et al. (2009) PTP inhibitor IV protects JNK kinase activity by inhibiting dual-specificity phosphatase 14 (DUSP14). Biochem Biophys Res Commun. 387 (4): 795-9.
  • TOP